University | National University of Singapore (NUS) |
Subject | Biotechnology |
In a study of brown bear populations in northwest North America. samples of mitochondria! DNA (mtDNA) was collected and sequenced from 317 free-ranging brown bears (Ursus arctos) from 22 locations. Forty-six variable regions in the mtDNA. corresponded to 26 haplotypes. clustered into four major clades (a clade is a group of organisms that is composed of a common ancestor and all its lineal descendants) Table 2 gives the mitochondria I sequence data and Table 1 gives the geographical locations at which bears with the corresponding haplotypes were found
a) You are lost somewhere in northwest North America. You collect a tissue sample from a brown bear in the vicinity and determine the following na DNA haplotype (relative to the reference sequence in Table 2)
Tx0ocrxxxAxxxxxxCxGTAxGGCTEcaxmAxxCxxxAxxT
Where are you’)
b) Additional sequences were collected from four polar bears from zoos
Reference sequence’
CCCTCCCAACGTTAACATTACGTAATCGAACAGCGGGTTAGGGAAC
81 xTxxxrnaxxxAxxxxxx)oCCGTAxGGxx)ocoamosocAxxT
82 xTxxxxxxxxxxitxxxxxxxxCCGTAxGGxxAxxxTxxxxxxAxxCxxxxxAT
83 xThoocrxxxxxAxxxxxxxxCCGTA4GGxxAxxxxGAxuAucCxxxxxAxa
84 xTuxxxxxxxxAmorxxxCCGTAxGGE<A>acccorAxxxioxxxxx)T
The reference sequence. from a brown bear. is the same as the reference sequence in Table 2.
To which class of brown bears are these polar bears most closely related? Where are the brown bears most closely related to polar bears found?
c) Assume that.
1) the original North American brown bear population contained all of the currently observed haplotypes. and
2) there is now a continuous brown bear habitat covering all areas listed in Table 1. What, then. accounts for the current geographical distribution of the different haplotype classes? There are two questions to address.
what accounted for their initial separation?
What is continuing to keep them separated?
Consider the following possible scenarios.
Climate change in the past. associated with glaciation, fragmented the population, and left pockets that reflect ‘founder effects’.
Climate change in the past, associated with glaciation, fragmented the population, and mutations within each group of bears accumulated to form separate halo groups.
Table 1: Sample collection locations of bears with sequences in Table 2. For instance, bears with the first haplotype of clade 3 were found at location B (latitude 48.0 degrees North, longitude 113.0 degrees West) and location E (latitude 51.0 degrees North, latitude 118.1 degrees West).
Table 2: Mitochondrial sequence data from brown bears in northwest North America. These data do not represent continuous sequences, but only the variable positions. An “x” indicates that the base at this position is the same as in the reference sequence
Clade I
xxTxTxTxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Q
xxTxTTTxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx PU
xxxxTxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Q
xxxxTxTxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxMOPRV
xxxxTTTxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGxx U
xxxxTTTxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx T
Clade II
xxxxxxTGGxxxxxxxxTxxxxxxxxxGxxxxxxxxxxxxxTxxxxxxxxAAxxx HN
xxxxxxTGGxxxxxxxGTxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAxGx G
xxxxxxTGGxxxxxxxxTxxxxxxxxxxxxxxxxGxxxxxxxxxxxGxxAAxGx LM
xxxxxxTGGxxxxxxxxTxxxxxxxxxxxxxxxxGxxxxxxxxxxxxxxAAxGx IJK
xxxxxxTGGxxxxxxxxTGxxxxxxxxxxxxxxxxxxxxxxTxxxxxxxAAxGx K
xxxxxxTGGxxxxxxxGTxxxGxxxxxxxxxxxxxxxxxxxxxxCxxxAAxGx H
xxxxxxTGGxxxxxxxxTxxxxxxxxxxxxxxxxxxxxxxxTxxxCxxxAAxGx H
xxxxxxTGGxxxxxxxxTxxxxxxxxxxxxxxxxxxxxxxxTxxxxxxxAAxGx H
xxxxxxTGGxxxxxxxGTxxxxxxxxxGxxxxxxxxxxxxxxxxCxxxAAxGx H
Clade III
TTxxTxTxxxxTxxxxCGxxxxxxxxxxxxxxxxxxxxxxxTxxxxxxAxAxxT BE
TTxxTxTxxxxTxxxxCGxxxxxxxCxxxxxxxxxxxxxxxTxxxxxxxxAxxT ABCDE
TTxxTxTxxxxTxxxxCGxxxxxxxCxxxxxxxxxxxxxxATAxxxxxxAxxT B
TTxxTxTxxxxxxxxxCGxxxxxxxCxxxxxxxxxxxxxxxTxxxxxxxxxxxT BC
TTxxTxTxxxxTxxxxCGxxxxxxxCxxxxxxxxxxxxxxxTxxxxxxxxxxxT A
TTxxTxTxxxxTxxxCCGxxxxxxxCxxxxxxxxxxxxxATAxxxxxxAxxT B
TTxxTxTxxxxTxxxxCGxxxxxxxCxxxxxxxxxxxxxxTxxxAxxxxAxxT A
TTxxTxTxxxxTxxxxCGxxxxxxxxxxxxxxxxGxxxxxTxxxAxxxxAxxT C
Clade IV
xTxCxxxxxAxxxCxxTAxGGCTxxxxxxxTxxxxxxxxxxAxxCxxxAxxT F
xTxCxxGxAxxxCxGTAxGGCTxxxxxxxTxxxxxxxxxxAxxCxxxAxxT F
xTxCxxxxAxxxCxGTAxGGCTxxxxxxxTxxxxxxxxxxAxxCxxxAGx F
Buy Custom Answer of This Assessment & Raise Your Grades
Thinking to pay someone to do my assignment in Singapore? then don't worry you are on the right website. At Singapore Assignment Help we have a group of talented and knowledgeable suss assignment experts who always ready to craft any typical solution on biotechnology assignment at a cheap price.
Looking for Plagiarism free Answers for your college/ university Assignments.
- A2429C Case Study Assignment: Glucose Homeostasis, Muscle Function, and Cardiovascular-Lymphatic Disorders
- Finance/ Wealth Management Assignment: Broker Report on Equity and Bond Valuation for Global Listed Companies
- PSB503IT Team Project Reflective Report Assignment: Enhancing Collaboration and Professional Development
- Microbiology Assignment: The Role of Medical Microbiologists in Disease Control and Their Contribution to Public Health
- A2389C Pharmaceutical Supply Chain Case Study Assignment: Emergency Preparedness Plan for Tariff Impact in Singapore
- Mobile Learning App Evaluation Report Assignment: Usability, Design, and Learning Outcome Analysis
- CTA Psychotherapy Intervention Essay Assignment: Sheila Case Study on Managing Anxiety and Marital Stress
- DSM500 Machine Learning Project Proposal: Retail Sales Forecasting with Time Series Models
- Project Management Assignment 2: The Shard UK Case Study on Risk & Stakeholder Strategies in Construction Projects
- CSIT121 Banking Application Assignment: OOP-Based Customer & Account Management System in Python